aconitase, trigger enzyme
product
aconitase, trigger enzyme
Genomic Context
categories
[category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.4|TCA cycle][category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids][category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW 3.4.3.4|Trigger enzyme that acts by binding of a specific RNA element][category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]Gene
Coordinates
1,926,680 → 1,929,409
Phenotypes of a mutant
glutamate auxotrophy and a defect in sporulation [Pubmed|9393699]The protein
Catalyzed reaction/ biological activity
Citrate --> isocitrate (according to UniProt)3-hydroxybutane-1,2,3-tricarboxylate --> 2-methyl-cis-aconitate + H2O (according to UniProt)Binding to iron responsive elements (IRE RNA) in the absence of the FeS cluster [Pubmed|23354745,10468622]2-methylaconitate --> 2-methyl-isocitrate in the methylcitric acid cycle [pubmed|28956599]Protein family
aconitase/IPM isomerase family (with [protein|AC459429A9C50463FD947C1CF9EA919B6FE3B335|LeuC], according to UniProt)[SW|Cofactors]
FeS cluster [pubmed|29292548]Structure
[PDB|2B3X] (the human enzyme, 53% identity) [pubmed|16407072]Additional information
''B. subtilis'' aconitase is both an enzyme and an RNA binding protein ([SW|moonlighting protein]) [Pubmed|10468622]extensive information on the structure and enzymatic properties of CitB can be found at [http://www.proteopedia.org/wiki/index.php/Aconitase Proteopedia]belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]Expression and Regulation
Other regulations
[protein|CE542AE1A32CCD1ABB259E6159F7A37A8078E189|FsrA]: translation repression, [Pubmed|18697947]Biological materials
Mutant
GP1275 Δ''citB''::''erm'', available in [SW|Jörg Stülke]'s labGP1441 ΔcitB::spc, available in [SW|Jörg Stülke]'s lab1A999 (''citB'')::''spec'', [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A999&Search=1A999 BGSC]GP2338 Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s labGP2339 Δ''[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]''::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s labBKE18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::erm trpC2)available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAGBKK18000 (Δ[gene|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCAAAATCCCCCTT, downstream forward: _UP4_TGATGAATCAATAGGAAGAGExpression vector
pGP1810 (N-terminal Strep-tag, purification from ''E. coli'', in [SW|pGP172]), available in [SW|Jörg Stülke]'s lablacZ fusion
pGP700 (in [SW|pAC5]), available in [SW|Jörg Stülke]'s labGFP fusion
GP1434 (spc, based on [SW|pGP1870]), available in [SW|Jörg Stülke]'s labtwo-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s labFLAG-tag construct
GP1144 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s labGP1145 (kan), available in [SW|Jörg Stülke]'s labAntibody
available in [SW|Linc Sonenshein]'s lablabs
[SW|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage][SW|Jörg Stülke], University of Göttingen, Germany [http://genmibio.uni-goettingen.de Homepage]References
Reviews
12732309,2696478,18261896,18086213,32850966 Original publications
18697947,20097860,2118511,12850135,2413006,10656796,10468622,6143742,16395550,16923907,9642180,9393699,12591885,2105305,20933603,21099137,21446632,21821766,22389480,23139400,23354745,20817675,15378759,16923908,21744456,11992126,28956599,16407072