SubtiBank SubtiBank
tsaE [2018-05-17 11:38:25]

tsaE [2018-05-17 11:38:25]

protein kinase, required for threonyl carbamoyl adenosine (t6A) modification of tRNAs that pair with ANN codons in mRNA
17.76 kDa
protein length
158 aa Sequence Blast
gene length
474 bp Sequence Blast
control of tRNA modification
protein kinase involved in tRNA modification

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    641,654 → 642,130

    Phenotypes of a mutant

  • reduced growth rate [Pubmed|19246765]
  • increased sensitivity to paraquat [pubmed|28890133]
  • The protein

    Catalyzed reaction/ biological activity

  • biosynthesis of the threonylcarbamoyladenosine (t6A) residue at position 37 of ANN-decoding tRNAs using L-threonylcarbamoyl-AMP ([protein|6CB350C335603D5F4434679F9D740BFECA738599|TsaB]-[protein|30393F16CFE89E7BAD233A0BD27B77D679F7E409|TsaD]-[protein|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|TsaE]) [Pubmed|23072323,21183954]
  • autophosphorylation on Ser-60, Thr-55, Thr-62, and Thr-64 [pubmed|28890133]
  • phosphorylation of [protein|30393F16CFE89E7BAD233A0BD27B77D679F7E409|TsaD] [pubmed|28890133]
  • Protein family

  • UPF0079 family (according to Swiss-Prot)
  • Kinetic information

  • K(M) for ATP: 60 myM, V(max) 10 nmol/min [Pubmed|19246765]
  • Modification

  • autophosphorylation on Ser-60, Thr-55, Thr-62, and Thr-64 [pubmed|28890133]
  • [SW|Cofactors]

  • Mg2+ [pubmed|28890133]
  • Structure

  • [PDB|5MVR] [Pubmed|28890133]
  • [SW|Localization]

  • cytoplasm with the exception of the nucleoid region [Pubmed|19246765]
  • Additional information

  • ATPase activity is required for ''in vivo'' function of the protein [Pubmed|19246765]
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE05910 (Δ[gene|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|tsaE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGCTTCACACGAGTCACCC, downstream forward: _UP4_ATGCTTTGTGAGGAGTTAAG
  • BKK05910 (Δ[gene|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|tsaE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGCTTCACACGAGTCACCC, downstream forward: _UP4_ATGCTTTGTGAGGAGTTAAG
  • Expression vector

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP833, available in [SW|Stülke] lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP841, available in [SW|Stülke] lab
  • References

  • 17005971,19246765,23072323,22383849,12112691,28890133