SubtiBank SubtiBank
tsaE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tsaE

protein kinase, required for threonyl carbamoyl adenosine (t6A) modification of tRNAs that pair with ANN codons in mRNA
locus
BSU_05910
pI
4.60
mw
17.76 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
function
control of tRNA modification
product
protein kinase involved in tRNA modification
essential
no
synonyms
ydiB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    641,654 → 642,130

    Phenotypes of a mutant

  • reduced growth rate [Pubmed|19246765]
  • increased sensitivity to paraquat [pubmed|28890133]
  • The protein

    Catalyzed reaction/ biological activity

  • biosynthesis of the threonylcarbamoyladenosine (t6A) residue at position 37 of ANN-decoding tRNAs using L-threonylcarbamoyl-AMP ([protein|6CB350C335603D5F4434679F9D740BFECA738599|TsaB]-[protein|30393F16CFE89E7BAD233A0BD27B77D679F7E409|TsaD]-[protein|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|TsaE]) [Pubmed|23072323,21183954]
  • autophosphorylation on Ser-60, Thr-55, Thr-62, and Thr-64 [pubmed|28890133]
  • phosphorylation of [protein|30393F16CFE89E7BAD233A0BD27B77D679F7E409|TsaD] [pubmed|28890133]
  • Protein family

  • TsaE family (single member, according to UniProt)
  • Kinetic information

  • K(M) for ATP: 60 myM, V(max) 10 nmol/min [Pubmed|19246765]
  • Modification

  • autophosphorylation on Ser-60, Thr-55, Thr-62, and Thr-64 [pubmed|28890133]
  • [SW|Cofactors]

  • Mg2+ [pubmed|28890133]
  • Structure

  • [PDB|5MVR] [Pubmed|28890133]
  • [SW|Localization]

  • cytoplasm with the exception of the nucleoid region [Pubmed|19246765]
  • Additional information

  • ATPase activity is required for ''in vivo'' function of the protein [Pubmed|19246765]
  • Expression and Regulation

    Operons

    genes
    [gene|DE32F1DA1EA1164411E0605262381BD38A49656C|thiL]-[gene|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|tsaE]-[gene|6CB350C335603D5F4434679F9D740BFECA738599|tsaB]-[gene|C2283BDD806221A285A27F24F52F92F4D47F0C55|ydiD]-[gene|30393F16CFE89E7BAD233A0BD27B77D679F7E409|tsaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE05910 (Δ[gene|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|tsaE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGCTTCACACGAGTCACCC, downstream forward: _UP4_ATGCTTTGTGAGGAGTTAAG
  • BKK05910 (Δ[gene|E15BB518649B2B9CD44CEBBB4FA481E55BCE823C|tsaE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTGCTTCACACGAGTCACCC, downstream forward: _UP4_ATGCTTTGTGAGGAGTTAAG
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with N-terminal Strep-tag, for [SW|SPINE], in [SW|pGP380]: pGP833, available in [SW|Stülke] lab
  • for expression/ purification from ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP841, available in [SW|Stülke] lab
  • References

  • 17005971,19246765,23072323,22383849,12112691,28890133,29741707