SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.38 kDa
protein length
139 aa Sequence Blast
gene length
417 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,702,688 → 2,703,104

    The protein

    Protein family

  • psiE family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]: activation, [Pubmed|18175906], in [regulon|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP regulon]
  • view in new tab

    Biological materials


  • MGNA-C503 (yrkR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE26410 (Δ[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTGTCTCCTATTT, downstream forward: _UP4_TAATAAATTAGTTCGCATTA
  • BKK26410 (Δ[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTGTCTCCTATTT, downstream forward: _UP4_TAATAAATTAGTTCGCATTA
  • References

  • 18175906