SubtiBank SubtiBank
yrkR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrkR

unknown
locus
BSU_26410
pI
8.82
mw
16.38 kDa
protein length
139 aa Sequence Blast
gene length
417 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,702,688 → 2,703,104

    The protein

    Protein family

  • psiE family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]-[gene|8A38FEFAA0FF91D989B77D40CBB3741902DC9D67|yrkQ]-[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]
    description
    [Pubmed|18175906]

    regulatory mechanism

  • [protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP]: activation, [Pubmed|18175906], in [regulon|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|YrkP regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C503 (yrkR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2501 NBRP B. subtilis, Japan]
  • BKE26410 (Δ[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTGTCTCCTATTT, downstream forward: _UP4_TAATAAATTAGTTCGCATTA
  • BKK26410 (Δ[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTGTCTCCTATTT, downstream forward: _UP4_TAATAAATTAGTTCGCATTA
  • References

  • 18175906