SubtiBank SubtiBank
yesJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yesJ

unknown
locus
BSU_06920
pI
4.87
mw
20.20 kDa
protein length
180 aa Sequence Blast
gene length
543 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yeeN,yfxC,yfxD

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    757,111 → 757,653

    The protein

    Protein family

  • [SW|Acetyltransferase family] (according to UniProt)
  • [SW|Domains]

  • [SW|N-acetyltransferase domain] (aa 31-180) (according to UniProt)
  • Structure

  • [PDB|2OH1] (from Listeria monocytogenes, 36% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|65A8D8D94E8E48DA28BA1F7BBB2FDBEB56A5EC72|cotJA]-[gene|536079E17C1CC18E77432D8006172D196B896EF8|cotJB]-[gene|8F21A4C6228A772B38597991AF43E6B0708339BF|cotJC]-[gene|E0DCE433B801FCEFF394ABAFE8CA73A0A0133257|yesJ]-[gene|FBE6C05AB3F3127F24C184B0E7F0165F372014D8|yesK]
    description
    [Pubmed|7768848]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|7768848,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|7768848], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE], [SW|SpoIIID]) [Pubmed|7768848]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A966 (yesJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/966 NBRP B. subtilis, Japan]
  • BKE06920 (Δ[gene|E0DCE433B801FCEFF394ABAFE8CA73A0A0133257|yesJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGGCCTCCCAATCAA, downstream forward: _UP4_TAAGCGTCCTTTGCAGGGGG
  • BKK06920 (Δ[gene|E0DCE433B801FCEFF394ABAFE8CA73A0A0133257|yesJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGGCCTCCCAATCAA, downstream forward: _UP4_TAAGCGTCCTTTGCAGGGGG
  • References

  • 7768848,15699190