SubtiBank SubtiBank
hag
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hag

flagellin protein, about 12,000 subunits make up one flagellum
locus
BSU35360
pI
4.78
mw
32.47 kDa
protein length
304 aa Sequence Blast
gene length
915 bp Sequence Blast
function
[SW|motility and chemotaxis]
product
flagellin protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.6|Other proteins required for efficient pellicle biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,634,987 → 3,635,901

    Phenotypes of a mutant

  • increased [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P formation, resulting in reduced [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] expression and strongly reduced [SW|genetic competence] [pubmed|28800172]
  • no swarming motility on B medium [Pubmed|19202088]
  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • few hours delay in pellicle development [Pubmed|26122431]
  • mutant has increased fitness in planktonic culture when competed with the wild-type NCIB3610 strain [Pubmed|26122431]
  • a substitution of Ala233 to Val results in straight flagella [pubmed|28800172]
  • The protein

    Protein family

  • bacterial flagellin family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|5A94391906ABFE70C5BA14E1E75343BC5805D0D9|YvzB]:
  • Structure

  • [PDB|3A5X] (from ''Salmonella typhimurium'', 42% identity) [pubmed|20228803]
  • the structure of flagellar filaments: [pubmed|29038601]
  • [SW|Localization]

  • extracellular (no signal peptide), major component of the secretome [Pubmed|18957862]
  • membrane [Pubmed|18763711]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • 12.000 monomers make up one flagellum [pubmed|31113895]
  • Expression and Regulation

    Operons

    genes
    [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]
    description
    [Pubmed|2498284]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|2498284], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12730172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19118355], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12730172]
  • view in new tab

    Other regulations

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA]: translation inhibition, [Pubmed|17555441]
  • Biological materials

    Mutant

  • GP901 (aphA3), GP902 (tet) [Pubmed|21856853], both available in [SW|Jörg Stülke]'s lab
  • 1A915 ( ''hag''::''cat''), [Pubmed|19202088], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A915&Search=1A915 BGSC]
  • 1A783 ( ''hag''::''erm''), [Pubmed|2174860], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A783&Search=1A783 BGSC]
  • 1A842 ( ''hag''::''kan''), [Pubmed|14762011], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A842&Search=1A842 BGSC]
  • DS1677 (marker-less in NCIB3610) [Pubmed|18566286]
  • BKE35360 (Δ[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGTTCCTCCCTG, downstream forward: _UP4_TAATTTTAAAAAAGACCTTG
  • BKK35360 (Δ[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGTTCCTCCCTG, downstream forward: _UP4_TAATTTTAAAAAAGACCTTG
  • Expression vectors

  • expression in ''B. subtilis'', in [SW|pBQ200]: pGP1089, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP1035 (in [SW|pAC6]), pGP755 (in [SW|pAC7]), there is also a series of promoter deletion variants in [SW|pAC6] and [SW|pAC7] [Pubmed|21856853], all available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • BP494 (bglS:: (hag-promoter-cfp-aphA3)), BP496 (amyE:: (hag-promoter-iyfp-cat)), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Daniel Kearns]
  • References

    Reviews

  • 22672726,25251856,26490009
  • Original Publications

  • 18566286,26122431,23144244,21602220,21856853,2498284,9648743,9096206,7708689,19202088,18763711,21895793,10809682,19118355,17555441,20534509,15378759,29038601,20228803,28800172,29124898,31113895