SubtiBank SubtiBank
hag
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

hag

flagellin protein, about 12,000 subunits make up one flagellum
locus
BSU_35360
pI
4.78
mw
32.47 kDa
protein length
304 aa Sequence Blast
gene length
915 bp Sequence Blast
function
[SW|motility and chemotaxis]
product
flagellin protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.6|Other proteins required for efficient pellicle biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.4|Swarming]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,634,987 → 3,635,901

    Phenotypes of a mutant

  • increased [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P formation, resulting in reduced [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK] expression and strongly reduced [SW|genetic competence] [pubmed|28800172]
  • no swarming motility on B medium [Pubmed|19202088]
  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • few hours delay in pellicle development [Pubmed|26122431]
  • mutant has increased fitness in planktonic culture when competed with the wild-type NCIB3610 strain [Pubmed|26122431]
  • a substitution of Ala233 to Val results in straight flagella [pubmed|28800172]
  • The protein

    Protein family

  • bacterial flagellin family (with [protein|82AB04023BCB57967C7501E6AEAC4BB593AA6480|FlgL] and [protein|5A94391906ABFE70C5BA14E1E75343BC5805D0D9|YvzB], according to UniProt)
  • Paralogous protein(s)

  • [protein|5A94391906ABFE70C5BA14E1E75343BC5805D0D9|YvzB]:
  • Structure

  • [PDB|3A5X] (from ''Salmonella typhimurium'', 42% identity) [pubmed|20228803]
  • the structure of flagellar filaments: [pubmed|29038601]
  • [SW|Localization]

  • extracellular (no signal peptide), major component of the secretome [Pubmed|18957862]
  • membrane [Pubmed|18763711]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • 12.000 monomers make up one flagellum [pubmed|31113895]
  • Expression and Regulation

    Operons

    genes
    [gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]
    description
    [Pubmed|2498284]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|2498284], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12730172], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|19118355], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • repressed during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|12730172]
  • view in new tab

    Other regulations

  • [protein|93F328524989597C7D2329B25E665496C9631E87|CsrA]: translation inhibition, [Pubmed|17555441]
  • Biological materials

    Mutant

  • GP901 (aphA3), GP902 (tet) [Pubmed|21856853], both available in [SW|Jörg Stülke]'s lab
  • 1A915 ( ''hag''::''cat''), [Pubmed|19202088], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A915&Search=1A915 BGSC]
  • 1A783 ( ''hag''::''erm''), [Pubmed|2174860], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A783&Search=1A783 BGSC]
  • 1A842 ( ''hag''::''kan''), [Pubmed|14762011], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A842&Search=1A842 BGSC]
  • DS1677 (marker-less in NCIB3610) [Pubmed|18566286]
  • BKE35360 (Δ[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGTTCCTCCCTG, downstream forward: _UP4_TAATTTTAAAAAAGACCTTG
  • BKK35360 (Δ[gene|E0BB77C8F1220E931D16A1FA6B75AE8907C76FDB|hag]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTTTTGTTCCTCCCTG, downstream forward: _UP4_TAATTTTAAAAAAGACCTTG
  • Expression vectors

  • expression in ''B. subtilis'', in [SW|pBQ200]: pGP1089, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP1035 (in [SW|pAC6]), pGP755 (in [SW|pAC7]), there is also a series of promoter deletion variants in [SW|pAC6] and [SW|pAC7] [Pubmed|21856853], all available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • BP494 (bglS:: (hag-promoter-cfp-aphA3)), BP496 (amyE:: (hag-promoter-iyfp-cat)), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Daniel Kearns]
  • References

    Reviews

  • 22672726,25251856,26490009
  • Original Publications

  • 18566286,26122431,23144244,21602220,21856853,2498284,9648743,9096206,7708689,19202088,18763711,21895793,10809682,19118355,17555441,20534509,15378759,29038601,20228803,28800172,29124898,31113895