SubtiBank SubtiBank
licR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

licR

transcriptional activator of the [gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH] operon
locus
BSU_38600
pI
6.11
mw
73.14 kDa
protein length
641 aa Sequence Blast
gene length
1926 bp Sequence Blast
function
regulation of lichenan utilization
product
transcriptional activator, [SW|PRD]-type
essential
no
ec
2.7.1.69
synonyms
celR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    3,962,003 → 3,963,928

    The protein

    Protein family

  • [SW|PRD-containing transcription factors]
  • [SW|Domains]

  • 2 [SW|PRD] domains (aa 184-289, aa 296-403)
  • [SW|PTS EIIB domain] type-2 (aa 407-498)
  • [SW|PTS EIIA domain] type-2 (aa 499-638)
  • Modification

  • phosphorylation (His219, His278, His333, His392, Cys413, His559) (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]
    description
    [Pubmed|8990303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8990303], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE38600 (Δ[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGAAAAACCTCCTAAC, downstream forward: _UP4_TGACAGCCTGTATATACCTT
  • BKK38600 (Δ[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGAAAAACCTCCTAAC, downstream forward: _UP4_TGACAGCCTGTATATACCTT
  • References

  • 8990303,10438772