SubtiBank SubtiBank
sodF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sodF

superoxide dismutase
locus
BSU19330
pI
6.17
mw
33.32 kDa
protein length
281 aa Sequence Blast
gene length
846 bp Sequence Blast
function
detoxification of oxygen radicals
product
superoxide dismutase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,104,056 → 2,104,901

    The protein

    Catalyzed reaction/ biological activity

  • 2 superoxide + 2 H+ = O2 + H2O2 (according to Swiss-Prot)
  • Protein family

  • terpene cyclase/mutase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|6153A07B961017052E1072944B59F510D80CEC0F|SodA]
  • [SW|Cofactors]

  • contains an iron-sulfur cluster
  • Structure

  • [PDB|3EVK] (aa 80 ... 280, from Pyrobaculum aerophilum, 54% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|24EB23F594F2B0EEA2E055857BA14FD9E361E0FD|sqhC]-[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]
    description
    [Pubmed|18436644]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18436644], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell [Pubmed|18436644]
  • view in new tab

    Biological materials

    Mutant

  • BKE19330 (Δ[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTGAACATCTCCGCTTGAT, downstream forward: _UP4_TAAAAAAAGCCCCCTTTCCT
  • BKK19330 (Δ[gene|E0645DD4A7A871457300139A7E5986EF11C07387|sodF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTGAACATCTCCGCTTGAT, downstream forward: _UP4_TAAAAAAAGCCCCCTTTCCT
  • References

  • 18436644