SubtiBank SubtiBank
ybcC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybcC

unknown
locus
BSU_01845
pI
5.73
mw
99.00 kDa
protein length
871 aa Sequence Blast
gene length
2616 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.4|Prophage 1]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    206,941 → 209,556

    The protein

    Protein family

  • UPF0753 family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]-[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]-[gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]-[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]-[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C509 (ybcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2507 NBRP B. subtilis, Japan]
  • BKE01845 (Δ[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01845 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCCCATCTCAGATTAGC, downstream forward: _UP4_TAATGATGAATCTAAGCATT
  • BKK01845 (Δ[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01845 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGCCCATCTCAGATTAGC, downstream forward: _UP4_TAATGATGAATCTAAGCATT