SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


RNase M16, endoribonuclease, required for the maturation of the 3' end of 16S rRNA
17.61 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
16S rRNA maturation
RNase M16

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW|Endoribonucleases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|rRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    2,611,808 → 2,612,281

    Phenotypes of a mutant

  • essential [pubmed|29873764]
  • the deletion can be suppressed by an additional deletion of [gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr] [pubmed|29873764]
  • The protein

    Catalyzed reaction/ biological activity

  • maturation of the 3' end of 16S rRNA [pubmed|29873764]
  • Protein family

  • Endoribonuclease YbeY family (single member, according to UniProt)
  • Structure

  • [PDB|1TVI] orthologue from ''T. maritima'' (38% identity) [Pubmed|15965736]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Biological materials


  • BKK25320 (Δ[gene|E0437C86E5F3707FF1DA13C8B98F73130DED8FB4|yqfG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGATATCAATCAGTAAAC, downstream forward: _UP4_AAGCAAAAGGAATTGCTGGA
  • References

  • 20807199,15965736,21325267,23273979,27834201,29873764