SubtiBank SubtiBank
yqfG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqfG

RNase M16, endoribonuclease, required for the maturation of the 3' end of 16S rRNA
locus
BSU25320
pI
4.19
mw
17.61 kDa
protein length
157 aa Sequence Blast
gene length
471 bp Sequence Blast
function
16S rRNA maturation
product
RNase M16
essential
yes
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.2|Endoribonucleases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.2|rRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    2,611,808 → 2,612,281

    Phenotypes of a mutant

  • essential [pubmed|29873764]
  • the deletion can be suppressed by an additional deletion of [gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr] [pubmed|29873764]
  • The protein

    Catalyzed reaction/ biological activity

  • maturation of the 3' end of 16S rRNA [pubmed|29873764]
  • Protein family

  • UPF0054 family (according to Swiss-Prot)
  • Structure

  • [PDB|1TVI] orthologue from ''T. maritima'' (38% identity) [Pubmed|15965736]
  • Biological materials

    Mutant

  • BKK25320 (Δ[gene|E0437C86E5F3707FF1DA13C8B98F73130DED8FB4|yqfG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25320 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AACGATATCAATCAGTAAAC, downstream forward: _UP4_AAGCAAAAGGAATTGCTGGA
  • References

  • 20807199,15965736,21325267,23273979,27834201,29873764