SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


alkaline phosphatase A
50.11 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
aquisition of phosphate upon phosphate starvation
alkaline phosphatase A

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.3|Phosphate metabolism]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,017,083 → 1,018,468

    The protein

    Catalyzed reaction/ biological activity

  • phosphate monoester + H2O --> alcohol + phosphate (according to UniProt)
  • Protein family

  • alkaline phosphatase family (with [protein|3B95AB3021280215B6B487A348D78FB5797AEEA6|PhoB], according to UniProt)
  • Paralogous protein(s)

  • [protein|3B95AB3021280215B6B487A348D78FB5797AEEA6|PhoB]
  • Structure

  • [PDB|3A52] (from Shewanella sp., mature protein without signal peptide, 40% identity) [pubmed|20057143]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8113174], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|16291680,8113174], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|16291680,8113174]
  • view in new tab

    Biological materials


  • 1A767 ( ''phoA''::''cat''), [Pubmed|9426145], available at [ BGSC]
  • BKE09410 (Δ[gene|E0430C16C41440633647976A0F9183E24268E198|phoA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTCCTTTAATGTATT, downstream forward: _UP4_TAAAAAGGATGCAGAACGCT
  • BKK09410 (Δ[gene|E0430C16C41440633647976A0F9183E24268E198|phoA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTCCTTTAATGTATT, downstream forward: _UP4_TAAAAAGGATGCAGAACGCT
  • labs

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [ Homepage]
  • References

  • 9593301,10913081,16491025,15699190,18957862,16291680,8113174,25666134,27118079,20057143