SubtiBank SubtiBank
mtrB

mtrB

tryptophan operon RNA-binding attenuation protein (TRAP), controls RNA switch in front of genes involved in biosynthesis and acquisition of tryptophan
locus
BSU_22770
pI
7.33
mw
8.19 kDa
protein length
gene length
228 bp Sequence Blast
function
regulation of tryptophan biosynthesis(and translation) attenuation in the trp operon;repression of the folate operon
product
tryptophan operon RNA-binding attenuation protein (TRAP)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.4|RNA binding regulators]
  • Gene

    Coordinates
    2,384,534 → 2,384,761

    The protein

    Protein family

  • MtrB family (single member, according to UniProt)
  • Effectors of protein activity

  • binding of tryptophan results RNA binding and thus in transcription termination
  • Structure

  • [PDB|3AQD], [PDB|1WAP] (complex with L-tryptophan), [PDB|2ZP9] (complex with [protein|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|RtpA])
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000015 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|folE]-[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]
    description
    [Pubmed|2123343]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2123343], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • constitutive [Pubmed|19767425]
  • view in new tab

    Biological materials

    Mutant

  • BKE22770 (Δ[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATAGCACCCTCTATC, downstream forward: _UP4_TAAGCTGGCTGTCCCCGCTG
  • BKK22770 (Δ[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22770 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTATAGCACCCTCTATC, downstream forward: _UP4_TAAGCTGGCTGTCCCCGCTG
  • References

    Reviews

  • 19385727,16285852,15063849,31100987
  • Original Publications

  • 22970197,19033375,17881743,10660627,10714985,12963367,14702295,16879415,17114058,17114263,11805104,7525975,10735881,15262953,14976255,8647825,18334255,10499579,7715723,8932308,11214184,15743934,7515880,9242649,7759487,15050822,14687568,9245598,9765233,11914485,15099736,7678334,8643393,15588817,16738132,1551827,17555767,7544009,11786553,11566976,2123343,11557884,12133840,16784236,10369778,7715723,10499579,11566976,7515880,21097886,21984911,24505391,24572018,24682818,25579595,27812824,28069823