SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to transcription regulator (Xre family)
8.44 kDa
protein length
gene length
225 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,203,779 → 2,204,003

    The protein

    Protein family

  • [SW|Xre family]
  • [SW|Domains]

  • [SW|HTH cro/C1-type domain] (aa 11-66) (according to UniProt)
  • Biological materials


  • BKE20780 (Δ[gene|E029C1E62EA8142799EC32DD86420349C757DC49|yopS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCGGACATCCTCCTG, downstream forward: _UP4_TGAAACGACTAAGACTTTGG
  • BKK20780 (Δ[gene|E029C1E62EA8142799EC32DD86420349C757DC49|yopS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATCGGACATCCTCCTG, downstream forward: _UP4_TGAAACGACTAAGACTTTGG
  • References

  • 23504016