SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


protein kinase D
29.91 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
protein kinase D

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    223,219 → 223,989

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
  • ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
  • phosphorylates [protein|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|DegS] on Ser-76 (in vitro) [Pubmed|21304896]
  • Protein family

  • [SW|protein kinase superfamily] (according to UniProt)
  • [SW|Ser/Thr protein kinase family] (according to UniProt)
  • [SW|Domains]

  • [SW|Protein kinase domain] (aa 25-256) (according to UniProt)
  • Modification

  • autophosphorylated on Thr-174 (''in vitro'') [Pubmed|20389117]
  • Structure

  • [PDB|4EQM] (PknB from Staphylococcus aureus, 34% identity in the N-terminal part, aa 18 ... 174) [pubmed|22701750]
  • Biological materials


  • MGNA-B958 (ybdM::erm), available at the [ NBRP B. subtilis, Japan]
  • GP578 (aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE02030 (Δ[gene|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|prkD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCACTTCCCTTGG, downstream forward: _UP4_CGCGAGGATCTAAACCGGGC
  • BKK02030 (Δ[gene|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|prkD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCACTTCCCTTGG, downstream forward: _UP4_CGCGAGGATCTAAACCGGGC
  • Expression vectors

  • pGP390 (N-terminal Strep-tag, purification from ''B. subtilis'', for [SW|SPINE], in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP821, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • for expression, purification in ''E. coli'' with N-terminal His-tag, in [SW|pWH844]: pGP1407, available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP830 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

  • 20389117,12406230,21304896,24731262,25278935,22701750