SubtiBank SubtiBank
ydhD
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydhD

spore coat peptidoglycan hydrolase
locus
BSU_05710
pI
9.07
mw
48.80 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
function
unknown
product
spore coat glycosylase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.6|Cell wall/ other/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.8|Not yet assigned]
  • Gene

    Coordinates
    616,672 → 617,934

    The protein

    Protein family

  • [SW|Glycosyl hydrolase 18 family] (according to UniProt)
  • Chitinase class II subfamily (with [protein|77BEC74867422AA225A1F12AD63464656DBDCBE8|YaaH], according to UniProt)
  • Paralogous protein(s)

  • [protein|77BEC74867422AA225A1F12AD63464656DBDCBE8|YaaH]
  • [SW|Domains]

  • contains two N-acetylglucosamine-polymer-binding [SW|LysM domain]s at the N-terminus [Pubmed|18430080]
  • [SW|glycoside hydrolase family 18 domain ] (aa 120 to 400)
  • 2 [SW|LysM domain]s (aa 2-45, aa 48-92) (according to UniProt)
  • Structure

  • [PDB|3CZ8]
  • [SW|Localization]

  • spore wall (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|ydhD]
    description
    [Pubmed|11011148]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|11011148,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation ([protein|search|SigE])
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C179 (ydhD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2177 NBRP B. subtilis, Japan]
  • BKE05710 (Δ[gene|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|ydhD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTAACCCCCATTATT, downstream forward: _UP4_TAAAAAAAGACACCAGAGCT
  • BKK05710 (Δ[gene|DFA0BFED9FC2C47ABAA2284514CE2F81BD9EDFEF|ydhD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05710 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTTAACCCCCATTATT, downstream forward: _UP4_TAAAAAAAGACACCAGAGCT
  • References

    Reviews

  • 18430080
  • Original publications

  • 11011148,15699190