SubtiBank SubtiBank
pghC
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pghC

phage-derived gamma polyglutamic acid hydrolase
locus
BSU_17270
pI
8.30
mw
26.72 kDa
protein length
235 aa Sequence Blast
gene length
708 bp Sequence Blast
function
polyglutamic acid degradation
product
phage-derived gamma polyglutamic acid hydrolase
essential
no
synonyms
ymaC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.4|Capsule biosynthesis and degradation]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,863,448 → 1,864,155

    The protein

    Catalyzed reaction/ biological activity

  • hydrolysis of polyglutamic acid [Pubmed|26158264]
  • Protein family

  • [SW|UPF0714 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|FD862CE6C4A37B17714F8F8687B3266D43EF5F63|PghL], [protein|8F9DCD77660706E4D25CD7875C014F6A2B5D8123|PghZ], [protein|BA7D1D112E934B68073DFC1F76248ED6157240E3|PghB]
  • [SW|Domains]

  • DUF867 [http://pfam.xfam.org/family/PF05908 x], [[gamma-PGA hydrolase domain]] [Pubmed|26158264]
  • Structure

  • [PDB|3A9L] (from B. subtilis phage NIT1, 40% identity) [pubmed|22105902]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DF95DED9A6E2160C151D7664C951B198EEA225E8|pghC]-[gene|0785B4C70C3DD00EFB8BCDD91EF4F98EF4372186|ymaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE17270 (Δ[gene|DF95DED9A6E2160C151D7664C951B198EEA225E8|pghC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTAACTCCTTTCATA, downstream forward: _UP4_TAACAAGCAGATCAGAAGAC
  • BKK17270 (Δ[gene|DF95DED9A6E2160C151D7664C951B198EEA225E8|pghC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTAACTCCTTTCATA, downstream forward: _UP4_TAACAAGCAGATCAGAAGAC
  • References

  • 26158264,22105902