SubtiBank SubtiBank
tuaD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tuaD

UDP glucose 6-dehydrogenase
locus
BSU35580
pI
6.11
mw
49.65 kDa
protein length
461 aa Sequence Blast
gene length
1386 bp Sequence Blast
function
biosynthesis of teichuronic acid
product
UDP glucose 6-dehydrogenase
essential
no
ec
1.1.1.22
synonyms
yvhD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.5|Biosynthesis of teichuronic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.4|Biosynthesis of teichuronic acid]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]
  • Gene

    Coordinates
    3,654,139 → 3,655,524

    The protein

    Catalyzed reaction/ biological activity

  • UDP-glucose + 2 NAD+ + H2O = UDP-glucuronate + 2 NADH (according to Swiss-Prot)
  • Protein family

  • UDP-glucose/GDP-mannose dehydrogenase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|Ugd], [protein|59024C05AA0106719C81E45E3B060A6F710B2690|YtcA]
  • Modification

  • phosphorylation on a Tyr residue by [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] [Pubmed|12970183], dephosphorylated by [protein|CF73D86DB024575BE8F043A4C3996458F4262E46|PtpZ] [Pubmed|15866923]
  • Effectors of protein activity

  • [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]-dependent phosphorylation stimulates TuaD activity [Pubmed|12970183]
  • Structure

  • [PDB|3GG2] (from Porphyromonas gingivalis, 48% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|5790E3DB39F31017B557C2D3F428C0348A461DA6|tuaA/2]-[gene|4AC72C556ED02A7DE4E1E8D69A0FC926359ACE28|tuaA/1]-[gene|54F96DE549F78E6C1580949A21C84B27AF26C4C6|tuaB]-[gene|873EE7A8C9BBFC6E96B0957B450BA665E3C9222D|tuaC]-[gene|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD]-[gene|B89FA71C2924CC0690224AFBFA06DB0FF0D97C0A|tuaE]-[gene|6F0FA23892BB1829174F66C464149DB428A8DE18|tuaF]-[gene|6E4F2BA67FF58085D462F6A6FB6497BDF600FCF6|tuaG]-[gene|737B37DA0DA1642AD5C4A824228BFED55FF0652A|tuaH]
    description
    [Pubmed|10048024]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10048024], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325,15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9611818,10627039], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]) [Pubmed|16497325,15699190]
  • view in new tab

    Biological materials

    Mutant

  • BKE35580 (Δ[gene|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCGCTCAACCCTCTCC, downstream forward: _UP4_TAAAAAGAAAAAGTGTTACT
  • BKK35580 (Δ[gene|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|tuaD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35580 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGCGCTCAACCCTCTCC, downstream forward: _UP4_TAAAAAGAAAAAGTGTTACT
  • References

  • 10913081,10376820,9611818,12970183,10048024,10627039,15866923,26923784