SubtiBank SubtiBank
yceD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yceD

general stress protein, similar to tellurium resistance protein
locus
BSU_02900
pI
4.29
mw
20.55 kDa
protein length
193 aa Sequence Blast
gene length
582 bp Sequence Blast
function
required for survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.12|Resistance against toxic metals/ based on similarity]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    312,780 → 313,361

    The protein

    Protein family

  • CAPAB/TerDEXZ family (with [protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|YceC] and [protein|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|YceE], according to UniProt)
  • Paralogous protein(s)

  • [protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|YceC], [protein|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|YceE]
  • Structure

  • [PDB|2KXT] (from Klebsiella pneumoniae, 59% identity) [pubmed|21112337]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]-[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]-[gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]-[gene|F16A11027D8D320D3D64E44038E29921A946955B|yceF]-[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]-[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|19047346], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B984 (yceD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1983 NBRP B. subtilis, Japan]
  • BKE02900 (Δ[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCACTCCTTT, downstream forward: _UP4_TAAGACAAATACGAAGAGCA
  • BKK02900 (Δ[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCACTCCTTT, downstream forward: _UP4_TAAGACAAATACGAAGAGCA
  • References

  • 15805528,18763711,11866510,18179421,19047346,21112337