SubtiBank SubtiBank
uvrB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

uvrB

excinuclease ABC (subunit B), required for transcription-dependent asymmetry in mutation rates of genes in the two orientations
locus
BSU_35170
pI
5.26
mw
76.15 kDa
protein length
661 aa Sequence Blast
gene length
1986 bp Sequence Blast
function
DNA repair after UV damage
product
excinuclease ABC (subunit B)
essential
no
synonyms
dinA,uvrA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    3,612,945 → 3,614,930

    Phenotypes of a mutant

  • a [gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA] [gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB] mutant is sensitive to blue light-induced DNA damage [pubmed|30054368]
  • The protein

    Protein family

  • UvrB family (with [protein|AD1F39823ABCE2A222259B879513752942C59590|Mfd], according to UniProt)
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 26-413) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 430-596) (according to UniProt)
  • [SW|UVR domain] (aa 625-660) (according to UniProt)
  • Structure

  • [PDB|2NMV] (bound to fluorescein-adducted DNA); [PDB|2D7D] ternary complex involving UvrB* (a C-terminal truncation of full-length UvrB), a polythymine trinucleotide and ADP [Pubmed|16426634]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB]-[gene|39B73AADBFD42203ADFA2E834697799E6430A086|uvrA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|8226626], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced upon DNA damage ([protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]) [Pubmed|8226626]
  • additional information

  • during [protein|search|sporulation] expressed both in the forespore and the mother cell [PubMed|24118570]
  • expression is induced in the presence of Cr(VI) [pubmed|30745368]
  • view in new tab

    Biological materials

    Mutant

  • GP1175 (del ''uvrAB''::''ermC'') (available in the [SW|Stülke] lab)
  • BKE35170 (Δ[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAATAAGCCTCCGTT, downstream forward: _UP4_CTAAAAGCGGAAGGATGATG
  • BKK35170 (Δ[gene|DEFBDC2AB8E43FB06C65389160E8EACFE5FB9705|uvrB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAAAAATAAGCCTCCGTT, downstream forward: _UP4_CTAAAAGCGGAAGGATGATG
  • References

    Reviews

  • 16464004,15927210,7801120,22933559
  • Original publications

  • 8226626,9555905,16426634,21821766,24147116,21145481,25713353,30054368