SubtiBank SubtiBank
albA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

albA

radical S-adenosylmethionine enzyme, antilisterial bacteriocin (subtilosin) production
locus
BSU37370
pI
6.20
mw
51.35 kDa
protein length
448 aa Sequence Blast
gene length
1347 bp Sequence Blast
function
antilisterial bacteriocin (subtilosin) production
product
radical S-adenosylmethionine enzyme
essential
no
synonyms
ywiA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    Coordinates
    3,836,323 → 3,837,669

    The protein

    Catalyzed reaction/ biological activity

  • catalyzes thioether bond formation in subtilosin A [Pubmed|22366720]
  • [SW|Cofactors]

  • contains two Fe-S clusters [Pubmed|22366720]
  • Structure

  • [PDB|6EFN] ([protein|F981C605C652D1A4429579A5F24608CE7F570834|SkfB],corresponds to aa 109 ... 382, 32% identity) [pubmed|30217813]
  • Expression and Regulation

    Operons

    genes
    [gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
    description
    [Pubmed|10572140]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B263 (ywiA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1262 NBRP B. subtilis, Japan]
  • BKE37370 (Δ[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATACCATCCCCTATAC, downstream forward: _UP4_CAGCTTATTTAGGAGGGAAA
  • BKK37370 (Δ[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAATACCATCCCCTATAC, downstream forward: _UP4_CAGCTTATTTAGGAGGGAAA
  • References

  • 10809709,10572140,15743949,10809710,10572140,17720793,17190806,30217813