SubtiBank SubtiBank
tyrA [2019-02-04 16:30:44]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tyrA [2019-02-04 16:30:44]

prephenate dehydrogenase
locus
BSU22610
pI
5.47
mw
41.28 kDa
protein length
371 aa Sequence Blast
gene length
1116 bp Sequence Blast
function
biosynthesis of tyrosine
product
prephenate dehydrogenase
essential
no
ec
1.3.1.12
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,369,251 → 2,370,366

    The protein

    Catalyzed reaction/ biological activity

  • Prephenate NAD = 4-hydroxyphenylpyruvate CO2 NADH (according to Swiss-Prot)
  • Protein family

  • prephenate/arogenate dehydrogenase family (according to Swiss-Prot)
  • [SW|Domains]

  • [SW|ACT domain] (aa 300 ... 371) (according to the Interpro database)
  • Effectors of protein activity

  • subject to feedback inhibition by tyrosine [Pubmed|4956345]
  • Structure

  • [PDB|3DZB] (from ''Streptococcus thermophilus'', 42% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    genes
    [gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • GP2358 ∆(''[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]''), kan, available in [SW|Jörg Stülke]'s lab
  • BKE22610 (Δ[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGTCATCACCTGGTTT, downstream forward: _UP4_TTTTATGCTGATTGAGGTGG
  • BKK22610 (Δ[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGTCATCACCTGGTTT, downstream forward: _UP4_TTTTATGCTGATTGAGGTGG
  • References

    Reviews

  • 12966138
  • Original publications

  • 21815947,3106153,4956345,3924737,6436812,1551827,8419914