SubtiBank SubtiBank
tyrA [2018-11-23 15:46:16]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tyrA [2018-11-23 15:46:16]

prephenate dehydrogenase
41.28 kDa
protein length
371 aa Sequence Blast
gene length
1113 bp Sequence Blast
biosynthesis of tyrosine
prephenate dehydrogenase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    2,369,251 → 2,370,366

    The protein

    Catalyzed reaction/ biological activity

  • Prephenate NAD = 4-hydroxyphenylpyruvate CO2 NADH (according to Swiss-Prot)
  • Protein family

  • HisMQ subfamily (according to Swiss-Prot)
  • Effectors of protein activity

  • subject to feedback inhibition by tyrosine [Pubmed|4956345]
  • Structure

  • [PDB|3DZB] (from ''Streptococcus thermophilus'', 42% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab


    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials


  • GP2358 (kan), available in [SW|Jörg Stülke]'s lab
  • BKE22610 (Δ[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGTCATCACCTGGTTT, downstream forward: _UP4_TTTTATGCTGATTGAGGTGG
  • BKK22610 (Δ[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACGTCATCACCTGGTTT, downstream forward: _UP4_TTTTATGCTGATTGAGGTGG
  • References


  • 12966138
  • Original publications

  • 21815947,3106153,4956345,3924737,6436812,1551827,8419914