SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


bacillithiol S-transferase, nuclease inhibitor
19.76 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
response to DNA damage
bacillithiol S-transferase, nuclease inhibitor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    608,246 → 608,764

    The protein

    Protein family

  • [SW|S-transferase-like (STL) superfamily] [pubmed|29451913]
  • [SW|DinB family] (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [PubMed|8226626,8969214], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [,8969214 PubMed]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • BKE05630 (Δ[gene|DEB7605B4F6F5F365A49C1C15647F9767B01BF66|bstG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAAAATTCCCCCTTT, downstream forward: _UP4_TAAAAAAGCGGCTCCCTAAA
  • BKK05630 (Δ[gene|DEB7605B4F6F5F365A49C1C15647F9767B01BF66|bstG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAAAATTCCCCCTTT, downstream forward: _UP4_TAAAAAAGCGGCTCCCTAAA
  • References

  • 12884008,1847907,8226626,8969214,9555905,16267290,29451913