SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


N-acetylmuramyl-L-alanine amidase
49.14 kDa
protein length
441 aa Sequence Blast
gene length
1326 bp Sequence Blast
recycling of cell wall material
N-acetylmuramyl-L-alanine amidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Utilization of cell wall components]
  • Gene

    188,408 → 189,733

    The protein

    Catalyzed reaction/ biological activity

  • hydrolyzes the amide bond between MurNAc and the L-alanine residue of the stem peptide [Pubmed|20400549]
  • Hydrolyzes the link between N-acetylmuramoyl residues and L-amino acid residues in certain cell-wall glycopeptides
  • Protein family

  • peptidase S12 family (single member, according to UniProt)
  • Structure

  • [PDB|4IVK] (from uncultured bacterium, 25% identity) [pubmed|23737193]
  • Expression and Regulation



    regulatory mechanism

  • [protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR]: repression, [pubmed|30038046], in [regulon|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR regulon]
  • regulation

  • expressed in late exponential and early stationary phase [Pubmed|20400549]
  • view in new tab

    Biological materials


  • BKE01670 (Δ[gene|DEACFD435DB01C4B3ADEF397BEE08E2E7C7FCC36|amiE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGGCTAGCCCCTTTCTG, downstream forward: _UP4_TGAATGATTAGACGATAGGA
  • BKK01670 (Δ[gene|DEACFD435DB01C4B3ADEF397BEE08E2E7C7FCC36|amiE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGGCTAGCCCCTTTCTG, downstream forward: _UP4_TGAATGATTAGACGATAGGA
  • References

  • 10627040,20400549,22383849,23737193,30038046