SubtiBank SubtiBank
yfiV
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfiV

similar to transcriptional regulator (MarR family)
locus
BSU_08410
pI
6.52
mw
18.07 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    916,124 → 916,606

    The protein

    [SW|Domains]

  • [SW|HTH marR-type domain] (aa 20-152) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DE880F5577B6D86B2E62437E392D48AFA9BCE48B|yfiV]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C357 (yfiV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2355 NBRP B. subtilis, Japan]
  • BKE08410 (Δ[gene|DE880F5577B6D86B2E62437E392D48AFA9BCE48B|yfiV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATCACTTCCTCATC, downstream forward: _UP4_TAAATCAGTAAGTCTGTCAT
  • BKK08410 (Δ[gene|DE880F5577B6D86B2E62437E392D48AFA9BCE48B|yfiV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08410 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATCACTTCCTCATC, downstream forward: _UP4_TAAATCAGTAAGTCTGTCAT