SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


thioredoxin-like protein
9.58 kDa
protein length
gene length
252 bp Sequence Blast
thioredoxin-like protein

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.3|Electron transport/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,930,447 → 1,930,698

    The protein

    Protein family

  • tlp family (single member, according to UniProt)
  • [SW|Localization]

  • spore core (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190,10333516], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,10333516], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG]) [Pubmed|15699190,10333516]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials


  • BKE18030 (Δ[gene|DE52E15D900F9665E35D2C8138DA3ABFC2B7B723|tlp]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGATGTACCTCCTAG, downstream forward: _UP4_TAAAAAACCAGGGAAACCTG
  • BKK18030 (Δ[gene|DE52E15D900F9665E35D2C8138DA3ABFC2B7B723|tlp]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCGGATGTACCTCCTAG, downstream forward: _UP4_TAAAAAACCAGGGAAACCTG
  • References

  • 16497325,15699190,10333516,30782632