SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


phosphatidylserine synthase
19.47 kDa
protein length
177 aa Sequence Blast
gene length
534 bp Sequence Blast
biosynthesis of phospholipids
phosphatidylserine synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    247,744 → 248,277

    The protein

    Catalyzed reaction/ biological activity

  • CDP-1,2-diacyl-sn-glycerol + L-serine --> 1,2-diacyl-sn-glycero-3-phospho-L-serine + CMP + H+ (according to UniProt)
  • Protein family

  • CDP-alcohol phosphatidyltransferase class-I family (with [protein|2DB0071F2B747A7D5607C7A1B51564C25DC0BA8D|PgsA], according to UniProt)
  • [SW|Localization]

  • cell membrane at the septum [Pubmed|15743965]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14762009], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • view in new tab

    Biological materials


  • BKE02270 (Δ[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTGTAACCAAACCTCC, downstream forward: _UP4_GCAGAAAACCTGGAGTCTGG
  • BKK02270 (Δ[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTGTAACCAAACCTCC, downstream forward: _UP4_GCAGAAAACCTGGAGTCTGG
  • References


  • 9370336
  • Original publications

  • 14762009,18820022,9422599,8829529,15743965,28376879