SubtiBank SubtiBank
amyE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

amyE

alpha-amylase
locus
BSU03040
pI
5.85
mw
72.62 kDa
protein length
660 aa Sequence Blast
gene length
1980 bp Sequence Blast
function
starch degradation
product
alpha-amylase
essential
no
ec
3.2.1.1
synonyms
amyA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.23|Utilization of starch/ maltodextrin]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    327,618 → 329,597

    The protein

    Catalyzed reaction/ biological activity

  • Endohydrolysis of (1→4)-alpha-D-glucosidic linkages in oligosaccharides and polysaccharides (according to Swiss-Prot)
  • Protein family

  • [SW|glycosyl hydrolase 13 family] (according to UniProt)
  • Structure

  • [PDB|1BAG] (complex with maltopentaose)
  • [SW|Localization]

  • secreted (according to Swiss-Prot), extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|E48DE0C73CB859E2B367B6800E85BD94836390A5|ycgB]-[gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]
    description
    [Pubmed|11320136]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3123701], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7665492], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|7665492]
  • view in new tab

    Biological materials

    Mutant

  • GP550 (cat), available in [SW|Stülke] lab
  • BKE03040 (Δ[gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTGACACTCCTTATT, downstream forward: _UP4_TGAGGGCAAGGCTAGACGGG
  • BKK03040 (Δ[gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTTGACACTCCTTATT, downstream forward: _UP4_TGAGGGCAAGGCTAGACGGG
  • References

    Reviews

  • 28724440
  • Original publications

  • 1904524,3123701,18957862,21948839,23262127,22900538,20817675,21512239,25431404