SubtiBank SubtiBank
ylbK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylbK

similar to patatin-like phospholipase
locus
BSU_15040
pI
9.16
mw
28.11 kDa
protein length
260 aa Sequence Blast
gene length
783 bp Sequence Blast
function
unknown
product
putative phospholipase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,571,981 → 1,572,763

    The protein

    Protein family

  • NTE family (single member, according to UniProt)
  • [SW|Domains]

  • PNPLA domain (aa 8-166) (according to UniProt)
  • Structure

  • [PDB|5FYA] (from Pseudomonas aeruginosa, 35% identity) [pubmed|27012424]
  • Expression and Regulation

    Operons

    genes
    [gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]-[gene|1A5C1BDE844AA56B90C0E4A02D74978676487E99|ddcP]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B247 (ylbK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1246 NBRP B. subtilis, Japan]
  • BKE15040 (Δ[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGTTAACCTCCTGCC, downstream forward: _UP4_ATAGAGAATTGGGAGGGCTC
  • BKK15040 (Δ[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGTTAACCTCCTGCC, downstream forward: _UP4_ATAGAGAATTGGGAGGGCTC
  • References

  • 20525796,27012424