SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to patatin-like phospholipase
28.11 kDa
protein length
260 aa Sequence Blast
gene length
783 bp Sequence Blast
putative phospholipase

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    1,571,981 → 1,572,763

    The protein

    Protein family

  • NTE family (single member, according to UniProt)
  • [SW|Domains]

  • PNPLA domain (aa 8-166) (according to UniProt)
  • Structure

  • [PDB|5FYA] (from Pseudomonas aeruginosa, 35% identity) [pubmed|27012424]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B247 (ylbK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15040 (Δ[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGTTAACCTCCTGCC, downstream forward: _UP4_ATAGAGAATTGGGAGGGCTC
  • BKK15040 (Δ[gene|DE3BCF20DE5BB438ACBB36B412817F6124CFDFFC|ylbK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCGTTAACCTCCTGCC, downstream forward: _UP4_ATAGAGAATTGGGAGGGCTC
  • References

  • 20525796,27012424