SubtiBank SubtiBank
ytbE
The papers of the month are back! Check them out! Link here

ytbE

putative aldo/keto reductase, may be involved in detoxification
locus
BSU29050
pI
4.79
mw
31.62 kDa
protein length
280 aa Sequence Blast
gene length
840 bp Sequence Blast
function
unknown
product
putative aldo/keto reductase
essential
no
ec
1.-.-.-
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,970,038 → 2,970,880

    Phenotypes of a mutant

  • essential [Pubmed|17114254], non-essential according to [Pubmed|28189581]
  • The protein

    Protein family

  • [SW|Nudix hydrolase], aldo/keto reductase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|994D5A36AECC75F5D0B59F7755BC5DB935ED6CE8|YvgN]
  • Structure

  • [PDB|3B3D] [Pubmed|19585557]
  • Expression and Regulation

    Operons

    genes
    [gene|BADE5937ECB41C96C82E6A3BDA8FDC9BFC21F219|ytbD]-[gene|DE12190315DADF13DA1BA272924729BBF909B1D9|ytbE]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A119 (ytbE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/119 NBRP B. subtilis, Japan]
  • BKE29050 (Δ[gene|DE12190315DADF13DA1BA272924729BBF909B1D9|ytbE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATTTCCTCCTTTA, downstream forward: _UP4_TAATGGCCAAAAAACACCGT
  • BKK29050 (Δ[gene|DE12190315DADF13DA1BA272924729BBF909B1D9|ytbE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTATTTCCTCCTTTA, downstream forward: _UP4_TAATGGCCAAAAAACACCGT
  • References

  • 17114254,19585557,28189581