SubtiBank SubtiBank
menH
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

menH

menaquinone biosynthesis methyltransferase
locus
BSU_22750
pI
8.17
mw
26.43 kDa
protein length
233 aa Sequence Blast
gene length
702 bp Sequence Blast
function
biosynthesis of menaquinone
product
menaquinone biosynthesis methyltransferase
essential
no
ec
2.1.1.163
synonyms
gerCB,menG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.8|Biosynthesis of menaquinone]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    2,382,907 → 2,383,608

    Phenotypes of a mutant

  • essential [http://www.ncbi.nlm.nih.gov/pubmed/?term=12682299 according to Kobayashi et al.]; however, inactivation reported by [http://www.ncbi.nlm.nih.gov/pubmed/?term=26735940 Meeske et al.] and [http://www.ncbi.nlm.nih.gov/pubmed/?term=20511502 Block et al.]
  • inactivation of ''[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]'' reduces sporulation efficiency to 12.7% that of wild type cells [Pubmed|26735940]
  • defective in biofilm formation [pubmed|31420537]
  • The protein

    Catalyzed reaction/ biological activity

  • 2-demethylmenaquinol + S-adenosyl-L-methionine --> menaquinol + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 26-259) (according to InterPro)
  • Structure

  • [PDB|1OBW] (from ''Saccharomyces cerevisiae'', 31% identity) [Pubmed|9201917]
  • Expression and Regulation

    Operons

    genes
    [gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]-[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]-[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]-[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]
    description
    [pubmed|22383849]
    view in new tab

    additional information

  • highly expressed at high iron concentrations [pubmed|31420537]
  • Biological materials

    Mutant

  • BKE22750 (Δ[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTTGAGTCCTGCATAA, downstream forward: _UP4_CTGTTTGAAGAGGCGGGCCT
  • BKK22750 (Δ[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTTGAGTCCTGCATAA, downstream forward: _UP4_CTGTTTGAAGAGGCGGGCCT
  • References

  • 9201917,26735940,20511502,31420537