SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


menaquinone biosynthesis methyltransferase
26.43 kDa
protein length
233 aa Sequence Blast
gene length
702 bp Sequence Blast
biosynthesis of menaquinone
menaquinone biosynthesis methyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of menaquinone]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    2,382,907 → 2,383,608

    Phenotypes of a mutant

  • essential [ according to Kobayashi et al.]; however, inactivation reported by [ Meeske et al.] and [ Block et al.]
  • inactivation of ''[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]'' reduces sporulation efficiency to 12.7% that of wild type cells [Pubmed|26735940]
  • defective in biofilm formation [pubmed|31420537]
  • The protein

    Catalyzed reaction/ biological activity

  • 2-demethylmenaquinol + S-adenosyl-L-methionine --> menaquinol + H+ + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|class I-like SAM-binding methyltransferase superfamily] (according to UniProt)
  • [SW|Domains]

  • [SW|AB hydrolase-1 domain] (aa 26-259) (according to InterPro)
  • Structure

  • [PDB|1OBW] (from ''Saccharomyces cerevisiae'', 31% identity) [Pubmed|9201917]
  • Expression and Regulation


    view in new tab

    additional information

  • highly expressed at high iron concentrations [pubmed|31420537]
  • Biological materials


  • BKE22750 (Δ[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTTGAGTCCTGCATAA, downstream forward: _UP4_CTGTTTGAAGAGGCGGGCCT
  • BKK22750 (Δ[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCTTTTGAGTCCTGCATAA, downstream forward: _UP4_CTGTTTGAAGAGGCGGGCCT
  • References

  • 9201917,26735940,20511502,31420537