SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


probable glycolate oxidase, iron-sulfur subunit
49.04 kDa
protein length
444 aa Sequence Blast
gene length
1335 bp Sequence Blast
probable glycolate oxidase, iron-sulfur subunit
ysfD, glcF

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,934,594 → 2,935,928

    The protein


  • 2 [SW|4Fe-4S ferredoxin-type domain]s (aa 14-46, aa 69-100) (according to UniProt)
  • [SW|Cofactors]

  • two Fe-S clusters [pubmed|29292548]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B005 (ysfD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28690 (Δ[gene|DDD01D9C50BC11A50D263946ECA15CB58570ACAA|glcF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATCTTTCCGCCACCAC, downstream forward: _UP4_TGAGAAAGCCCAAAACAGAC
  • BKK28690 (Δ[gene|DDD01D9C50BC11A50D263946ECA15CB58570ACAA|glcF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTCATCTTTCCGCCACCAC, downstream forward: _UP4_TGAGAAAGCCCAAAACAGAC
  • References

  • 8969504,27264531,8606183