SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


oligopeptide [SW|ABC transporter] (permease)
33.47 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
initiation of [SW|sporulation], competence development
oligopeptide [SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of peptides]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of peptides]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,222,533 → 1,223,450

    The protein

    Catalyzed reaction/ biological activity

  • required for the uptake of quorum sensing peptides such as [protein|4FA7D6E6316A6FC71C10C692D125833263894020|PhrH] [Pubmed|21908671]
  • Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|OppBC subfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|EDF8D2C49FA5552B24135E12524F9035E1E01473|DppC], [protein|252E3F0A05D78CEC46A08B46D1C6133239B6B8BA|AppC]
  • [SW|Domains]

  • [SW|ABC transmembrane type-1 domain] (aa 103-292) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|10092453]
  • Expression and Regulation



    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: activation, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, no derepression occurs, however, in a [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY] mutant, due to increased repression by [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC] [Pubmed|25966844], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|10383984], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • regulation

  • expressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|trpS]' and '[protein|search|oppA]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BP68 (spc) available in [SW|Fabian Commichau]'s lab
  • GP2097 (D(''[gene|302DFA46D73E18C4663468ED6033C55056744475|oppA]-[gene|B0A3C7B253FB1DA1D4BC9D1D564905ECE8A65BC1|oppB]-[gene|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC]-[gene|05752B9C4EA7ACD579D65D028B7DF1861F3840CB|oppD]-[gene|38AD697B6C9967B8BD7496E31264A21F6D0A9DEE|oppF]'')::''aphA3''), available in [SW|Jörg Stülke]'s lab
  • BKE11450 (Δ[gene|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCCTAGGCTCCTTTCT, downstream forward: _UP4_GATCCTAAGTTACGTAAATA
  • BKK11450 (Δ[gene|DDBCE73B6AF39E5D669475479186C93F287DA9FC|oppC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCCTAGGCTCCTTTCT, downstream forward: _UP4_GATCCTAAGTTACGTAAATA
  • References

  • 27231947,1901616,10092453,9252573,21908671,12823818,10383984,7997159,25966844,1899858,25755103