SubtiBank SubtiBank
ykuC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykuC

similar to macrolide-efflux protein
locus
BSU_14030
pI
9.92
mw
47.93 kDa
protein length
430 aa Sequence Blast
gene length
1293 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,475,150 → 1,476,442

    Phenotypes of a mutant

  • increased conjugation of ICEBs1 [Pubmed|25069588]
  • The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|ykuE]-[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]-[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]
    description
    [Pubmed|22383849]

    regulation

  • expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A765 (ykuC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/765 NBRP B. subtilis, Japan]
  • BKE14030 (Δ[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACGCTCCTTACCC, downstream forward: _UP4_TAATGCAGGTTAAAAATGCG
  • BKK14030 (Δ[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACGCTCCTTACCC, downstream forward: _UP4_TAATGCAGGTTAAAAATGCG
  • References

  • 22383849,25069588