SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component response regulator
23.88 kDa
protein length
214 aa Sequence Blast
gene length
645 bp Sequence Blast
two-component response regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    1,009,804 → 1,010,448

    The protein

    Paralogous protein(s)

  • [protein|EFEAF09E4449A022A7323450FDED9458426A0080|YdfI], [protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|YxjL], [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK], [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 2-118) (according to UniProt)
  • [SW|HTH luxR-type domain] (aa 142-207) (according to UniProt)
  • Modification

  • phosphorylated on a Asp residue by [protein|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|YhcY]
  • Structure

  • [PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 44% identity) [pubmed|27670715]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16816187], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR]: activation, [Pubmed|16816187], in [regulon|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|LiaR regulon]
  • view in new tab

    Biological materials


  • MGNA-A730 (yhcZ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE09330 (Δ[gene|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATACCGCCCCTCCTTT, downstream forward: _UP4_AAATGAACATGTTAGTCATA
  • BKK09330 (Δ[gene|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCATACCGCCCCTCCTTT, downstream forward: _UP4_AAATGAACATGTTAGTCATA
  • References

  • 10094672,20639339,16816187,27670715,29785949