SubtiBank SubtiBank
xtmA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

xtmA

PBSX terminase (small subunit)
locus
BSU_12570
pI
9.54
mw
30.09 kDa
protein length
265 aa Sequence Blast
gene length
798 bp Sequence Blast
function
phage DNA replication
product
PBSX terminase (small subunit)
essential
no
synonyms
ykxF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    Coordinates
    1,325,096 → 1,325,893

    The protein

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Expression and Regulation

    Operons

    genes
    [gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]-[gene|277F51EB4FE2BAB0FD1808EDE25705E10833AD0A|xtmB]-[gene|E77DD93E3CDCA9B81106E6AB0F18513360AAE9DB|xkdE]-[gene|6542BE447872C1A16C056DA21BD7A23C65F5C543|xkdF]-[gene|38173C76C27A7178CEE66E3642533EB34828C2CB|xkdG]-[gene|81C6812565B3E8ADCB19F52BDFFA9E55B94A2E9D|xkdH]-[gene|5ACCC439AD8849355094F8C5FC6EF29A9077EF58|xkdI]-[gene|6DF19E4546509687CA194F6B44EEB723C9467B9C|xkdJ]-[gene|31B1832E5EAD957EE6A5C7CB0C117EC0F26AA8AB|xkdK]-[gene|683D350D98AC0D27951145AD87830B89C0B4F393|xkdM]-[gene|0BF8AD1ACD0BBA6913636081B41E6D04D16D1BA2|xkdN]-[gene|156A8B699B32B268EBA1A0A1620C95D0DF630A4E|xkzB]-[gene|CD97483876F4FCCE451AD4F2A8AFD6F560074769|xkdO]-[gene|ED35852FAAD386CFB43F8D3DDEF28F7B05EC8B43|xkdP]-[gene|D5FDCC792D0E6B8D35BCDDC0D7B76025ACC900FF|xkdQ]-[gene|AF9706F2EBF056A404B5D7640D78D1E833805225|xkdR]-[gene|C222F247C225FD6DEBB103DFB169AEF87DFC0C0D|xkdS]-[gene|1234C9BC164FB47E003009E943124982260221C0|xkdT]-[gene|BDE032590D5F3504CDB4D6BD545153D681B65ADD|xkdU]-[gene|3BCF7587145CFEDEA2F36512ABF62D6B6A2886C5|xkzA]-[gene|9FAAA2E63B161862396C47CE5D1EA9191847FDAD|xkdV]-[gene|1F152F97AD20DABAC1D83EDC2177F46EAECC562C|xkdW]-[gene|787561F433911D090F801AD493F688895498542F|xkdX]-[gene|27BB6659541BA5368DEDB19EADCD372CE41244F5|xepA]-[gene|630FC0D9BDD243D6BF94DBDE506EC2A9CB0AAFE6|xhlA]-[gene|360D866E939DDB822AFAC589D563B191A88695CD|xhlB]-[gene|50D7B97E4D3D41F74EF1942B85DE1DA4A33BEBB0|xlyA]
    description
    [Pubmed|22383849,2110147]

    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • BKE12570 (Δ[gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTACTGCATCACCGCC, downstream forward: _UP4_ATCAAACGAAAAGAGCGCAA
  • BKK12570 (Δ[gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12570 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTACTGCATCACCGCC, downstream forward: _UP4_ATCAAACGAAAAGAGCGCAA
  • References

  • 2110147,8083174