SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


PBSX terminase (small subunit)
30.09 kDa
protein length
265 aa Sequence Blast
gene length
798 bp Sequence Blast
phage DNA replication
PBSX terminase (small subunit)

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.1|PBSX prophage]
  • Gene

    1,325,096 → 1,325,893

    The protein

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Expression and Regulation



    sigma factors

  • [protein|458406A4E6824C24493CFC19718F10720AA3B453|Xpf]: sigma factor, [Pubmed|8083174], in [regulon|458406A4E6824C24493CFC19718F10720AA3B453|Xpf regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • BKE12570 (Δ[gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTACTGCATCACCGCC, downstream forward: _UP4_ATCAAACGAAAAGAGCGCAA
  • BKK12570 (Δ[gene|DD4F52FE386EF75009ECF594ED4E2D1593220E4F|xtmA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTACTGCATCACCGCC, downstream forward: _UP4_ATCAAACGAAAAGAGCGCAA
  • References

  • 2110147,8083174