SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


similar to [SW|ABC transporter] (membrane protein)
27.99 kDa
protein length
259 aa Sequence Blast
gene length
777 bp Sequence Blast
[SW|ABC transporter] (membrane protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Exporters] → [category|SW|Export of peptides]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,967,944 → 3,968,720

    The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY]: sigma factor, [Pubmed|12897008], in [regulon|801E92306971E26AD4AB155172B7F4EFDE2F9170|SigY regulon]
  • view in new tab

    Biological materials


  • MGNA-B753 (yxlG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38650 (Δ[gene|DCC03844AC58A198B851B564D0A6459C39EBDA2F|yxlG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATGCGTGCACCACCTT, downstream forward: _UP4_TATTAATTGATCATGTTACG
  • BKK38650 (Δ[gene|DCC03844AC58A198B851B564D0A6459C39EBDA2F|yxlG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCATGCGTGCACCACCTT, downstream forward: _UP4_TATTAATTGATCATGTTACG
  • References

  • 14769884,10092453,12897008