SubtiBank SubtiBank
yozT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yozT

unknown
locus
BSU_18709
pI
8.00
mw
9.00 kDa
protein length
gene length
240 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,040,988 → 2,041,227

    Expression and Regulation

    Operons

    genes
    [gene|C84D95CFF23CE8206182C4111ACDCE3E51A6B201|yoaR]-[gene|1C01BD9A19036C9897ED6D8BFAFE7E7E77A29C3C|yozF]-[gene|DCA56BBD34F988F16FBF9E67C0C85975E052D96C|yozT]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • BKE18709 (Δ[gene|DCA56BBD34F988F16FBF9E67C0C85975E052D96C|yozT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE18709 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTGACATTTGACTCAG, downstream forward: _UP4_TCATTAAAAACCGCTAATTT
  • BKK18709 (Δ[gene|DCA56BBD34F988F16FBF9E67C0C85975E052D96C|yozT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK18709 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTGACATTTGACTCAG, downstream forward: _UP4_TCATTAAAAACCGCTAATTT
  • References

  • 27766092