SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


control of chemotaxis by interacting with [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|CheD], [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY]-P phosphatase, inhibition of [protein|1217807AE3AE3A654BA0DD4AF5ADF1CEE62632B6|CheR]-mediated methylation of MCPs
22.90 kDa
protein length
209 aa Sequence Blast
gene length
630 bp Sequence Blast
motility and chemotaxis
[protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY]-P phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Soluble signalling proteins]
  • Gene

    1,715,344 → 1,715,973

    The protein

    Catalyzed reaction/ biological activity

  • [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY]-P phosphatase
  • controls binding of [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|CheD] to chemoreceptors in response to the levels of [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY]-P [Pubmed|23226535]
  • Protein family

  • CheC family (single member, according to UniProt)
  • Paralogous protein(s)

  • [protein|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|FliY]
  • Effectors of protein activity

  • interaction with [protein|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|CheD] enhances phosphatase activity towards [protein|2F0495C7EAB81BDB1F3181677C555537BD2A972F|CheY]-P [Pubmed|17908686]
  • Structure

  • [PDB|2F9Z] (from Thermotoga maritima, 31% identity) [pubmed|16469702]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials


  • 1A862 (no resistance), [Pubmed|7893679], available at [ BGSC]
  • DS6867 (marker-less in NCIB3610) [Pubmed|25313396]
  • BKE16450 (Δ[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATGTCATAACCCCTTT, downstream forward: _UP4_TTTGTCGCCTTAGGTGCATC
  • BKK16450 (Δ[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACTCATGTCATAACCCCTTT, downstream forward: _UP4_TTTGTCGCCTTAGGTGCATC
  • References


  • 30718302
  • Original Publications

  • 25313396,7893679,14993307,18774298,8866475,18990184,17908686,14749334,11722727,9194713,14651647,9657996,8157612,15175317,17609139,16469702,20080618,17675386,20133180,17850253,21515776,23226535,24386445,16469702