SubtiBank SubtiBank
flgE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

flgE

flagellar hook protein
locus
BSU16290
pI
4.73
mw
27.32 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
movement and chemotaxis
product
flagellar hook protein
essential
no
synonyms
flgG

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.2|Flagellar proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.6|Other proteins required for efficient pellicle biofilm formation]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,700,182 → 1,700,976

    Phenotypes of a mutant

  • not essential for pellicle biofilm formation, but mutant is outcompeted by the wild-type strain when competed during pellicle formation [Pubmed|26122431]
  • The protein

    Protein family

  • [SW|Flagella basal body rod proteins family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|13F35BC7EE8215D7A92A639BEB18647AC276D215|FlhP], [protein|8EFE091CFB89FC406CD60776977C9C302C7826E0|FlhO]
  • Structure

  • [PDB|3A69] (from ''Salmonella enterica'', 44% identity) [Pubmed|19913483]
  • [SW|Localization]

  • bacterial flagellum basal body (according to UniProt)
  • extracellular (no signal peptide) [Pubmed|18957862]
  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
    description
    [Pubmed|20233303]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|20233303], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: regulation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • regulation

  • see [SW|fla-che operon]
  • view in new tab

    genes
    [gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]-[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]-[gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]-[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]-[gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]-[gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]-[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]-[gene|600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC|fliJ]-[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliZ]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
    description
    [Pubmed|9657996,8157612,15175317]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9657996], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|9657996], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA]: activation, in [regulon|5D479874B43F521DB52EDC2C27CDE4967F22DE47|SwrA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • view in new tab

    Biological materials

    Mutant

  • DS4681 (marker-less in NCIB3610) [Pubmed|22730131]
  • BKE16290 (Δ[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATATTCCCCCAGAT, downstream forward: _UP4_TAAGGAGGGAGGGGAGGCGA
  • BKK16290 (Δ[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATATATTCCCCCAGAT, downstream forward: _UP4_TAAGGAGGGAGGGGAGGCGA
  • References

    Reviews

  • 26490009
  • Original publications

  • 26122431,14651647,18957862,18763711,9657996,8157612,15175317,17850253,24386445,22730131,19913483,30201778