SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


uracil-DNA glycosylase
25.90 kDa
protein length
225 aa Sequence Blast
gene length
678 bp Sequence Blast
DNA repair
uracil-DNA glycosylase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    3,897,685 → 3,898,362

    Phenotypes of a mutant

  • increased mutation rates [Pubmed|22056936]
  • The protein

    Catalyzed reaction/ biological activity

  • removes uracil preferentially from single-stranded DNA over double-stranded DNA, exhibiting higher preference for U:G than U:A mismatches [Pubmed|21542855]
  • Protein family

  • uracil-DNA glycosylase (UDG) superfamily (single member, according to UniProt)
  • Structure

  • [PDB|3A7N] (from ''Mycobacterium tuberculosis'', 42% identity) [Pubmed|20693660]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation




  • expressed throughout growth and staionary phase [Pubmed|22056936]
  • view in new tab

    view in new tab

    Biological materials


  • BKE37970 (Δ[gene|DC73C11C3C54D35B2D9A0A28666A29E36451E7F8|ung]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCTGTTTCAAGATTCAGG, downstream forward: _UP4_TAAAAAGCGCAGGTGATCTG
  • BKK37970 (Δ[gene|DC73C11C3C54D35B2D9A0A28666A29E36451E7F8|ung]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AAGCTGTTTCAAGATTCAGG, downstream forward: _UP4_TAAAAAGCGCAGGTGATCTG
  • References


  • 22933559
  • Original publications

  • 9353933,20693660,22056936,21170359,21542855,25326311,27530626