SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


lipoprotein, similar to zinc-binding protein
28.72 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
zinc-binding protein
zinc uptake

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Zinc]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,741,357 → 2,742,112

    The protein

    Protein family

  • calycin superfamily (single member, according to UniProt)
  • Structure

  • [PDB|1S7D] (the extracellular domain of E. coli ZinT, 46% identity)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|25649915], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • induced by zinc starvation ([protein|search|Zur]) [Pubmed|25649915]
  • view in new tab

    Biological materials


  • MGNA-A142 (yrpE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE26830 (Δ[gene|DC6BA360289AFEC4E098AFDEE9C4E7FA02EA40F8|zinT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAACACTCCTTTTTT, downstream forward: _UP4_TAAATGATGATTACTCTATG
  • BKK26830 (Δ[gene|DC6BA360289AFEC4E098AFDEE9C4E7FA02EA40F8|zinT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAACACTCCTTTTTT, downstream forward: _UP4_TAAATGATGATTACTCTATG
  • References

  • 12904577,25649915,18957862,27561249,20097857