SubtiBank SubtiBank
zinT
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

zinT

lipoprotein, similar to zinc-binding protein
locus
BSU_26830
pI
5.12
mw
28.72 kDa
protein length
251 aa Sequence Blast
gene length
756 bp Sequence Blast
function
zinc-binding protein
product
zinc uptake
essential
no
synonyms
yrpE

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.3|Zinc]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    2,741,357 → 2,742,112

    The protein

    Protein family

  • calycin superfamily (single member, according to UniProt)
  • Structure

  • [PDB|1S7D] (the extracellular domain of E. coli ZinT, 46% identity)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|DC6BA360289AFEC4E098AFDEE9C4E7FA02EA40F8|zinT]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur]: repression, in the presence of zinc [Pubmed|25649915], in [regulon|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur regulon]
  • regulation

  • induced by zinc starvation ([protein|search|Zur]) [Pubmed|25649915]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A142 (yrpE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/142 NBRP B. subtilis, Japan]
  • BKE26830 (Δ[gene|DC6BA360289AFEC4E098AFDEE9C4E7FA02EA40F8|zinT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAACACTCCTTTTTT, downstream forward: _UP4_TAAATGATGATTACTCTATG
  • BKK26830 (Δ[gene|DC6BA360289AFEC4E098AFDEE9C4E7FA02EA40F8|zinT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCAACACTCCTTTTTT, downstream forward: _UP4_TAAATGATGATTACTCTATG
  • References

  • 12904577,25649915,18957862,27561249,20097857