SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


transcription repressor of the [gene|BC568649A341B2E6341993EDA4BF52BDE18A3294|treP]-[gene|2EB9E0C492DF57DF683817E31D6DD34D7580E631|treA]-[gene|search|treR ]operon ([SW|GntR family])
27.69 kDa
protein length
238 aa Sequence Blast
gene length
717 bp Sequence Blast
regulation of trehalose utilization
transcription repressor ([SW|GntR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of trehalose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • Gene

    853,556 → 854,272

    The protein

    Protein family

  • [SW|GntR family] of transcription factors
  • [SW|Domains]

  • [SW|HTH gntR-type domain] (aa 1-71) (according to UniProt)
  • Structure

  • [PDB|2OGG] (effector binding domain) [Pubmed|17705272]
  • additional information

  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8755887], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR]: repression, [Pubmed|8755887], in [regulon|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|TreR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|18977770], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|21636651], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • regulation

  • expressed under conditions of phosphate limitation ([protein|search|PhoP]) [Pubmed|21636651]
  • view in new tab

    Biological materials


  • MGNA-C261 (treR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07820 (Δ[gene|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|treR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGGACCACCCAGCTT, downstream forward: _UP4_TGAGAGAGGCGCCTGCCTGC
  • BKK07820 (Δ[gene|DC374E280C5A67C138D7EAC43AA66DA63CEF82B6|treR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATGGACCACCCAGCTT, downstream forward: _UP4_TGAGAGAGGCGCCTGCCTGC
  • References

  • 8755887,9829827,8917076,17705272,18977770