SubtiBank SubtiBank
sigH
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

sigH

[SW|RNA polymerase] [SW|sigma factor] SigH, not fully active in laboratory strains due to a mutation (V117A)
locus
BSU00980
pI
5.15
mw
25.30 kDa
protein length
218 aa Sequence Blast
gene length
654 bp Sequence Blast
function
transcription of early stationary phase genes (sporulation, competence)
product
[SW|RNA polymerase] [SW|sigma factor] SigH
essential
no
synonyms
spo0H

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.1|Transcription] → [category|SW 3.2.1.2|Sigma factors]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.1|Sigma factors]
  • Gene

    Coordinates
    116,600 → 117,256

    The protein

    Protein family

  • sigma-70 factor family (according to Swiss-Prot)
  • Additional information

  • not fully active in laboratory strains due to a mutation (V117A) [pubmed|27501195]
  • the poor interaction of [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH] with the [SW|RNA polymerase] is responsible for the poor [SW|sporulation] at high salinity, this phenotype can be partially suppressed by specific mutations in [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH] [Pubmed|26712348]
  • Expression and Regulation

    Operons

    genes
    [gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]
    description
    (DBTBS) null

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1898930], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|7592498], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • repressed during logrithmic growth ([protein|search|AbrB]) [Pubmed|7592498]
  • view in new tab

    Biological materials

    Mutant

  • BKE00980 (Δ[gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA
  • BKK00980 (Δ[gene|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCCGATCCCCCCGGCGC, downstream forward: _UP4_TAATAGGAATTTATGCTATA
  • Labs working on this gene/protein

  • [SW|Charles Moran], Emory University, NC, USA [http://www.microbiology.emory.edu/moran_c.html homepage]
  • References

    Reviews

  • 20833318
  • The [SW|SigH regulon]

  • 12169614
  • Original Publications

  • 1391042,3123466,2122453,3127379,2502532,6405278,2118512,2509422,1904128,3007003,2500529,9733708,11377871,8600030,7592498,1898930,2509423,20154131,26712348,28507241,27501195