SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


secreted quality control protease
96.29 kDa
protein length
894 aa Sequence Blast
gene length
2685 bp Sequence Blast
protein quality control
secreted quality control protease

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Protein quality control]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,153,789 → 1,156,473

    The protein

    Catalyzed reaction/ biological activity

  • important for [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY]-dependent export of [protein|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|YkuE] and [protein|3985F88334D7B034A66473C5BB39188AB61A65F6|EfeB] [Pubmed|23180473]
  • involved in degradation of [protein|6EE13E61A218A6D52BAC83A1145B0B96961CE289|PrsA], [protein|76FA52D5A5F9FCA14BA9B45872FE3D99D89B211B|HtrA], and [protein|796216BE9CD6DADFEADC29497253C81BF496A2ED|HtrB] [Pubmed|24362423]
  • Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|peptidase S8 domain] (aa 422-729) (according to UniProt)
  • Structure

  • [PDB|1DBI] (the peptidase S8 domain from Bacillus sp., aa 458 ... 687, 46% identity) [pubmed|10588904]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • membrane [Pubmed|18763711]
  • cell wall [Pubmed|23180473]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22900538], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|22900538]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for'[protein|search|wprA]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • 1A1021 ( ''wprA''::''kan''), [Pubmed|20400548], available at [ BGSC]
  • BKE10770 (Δ[gene|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|wprA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCCCTCCTGCAAA, downstream forward: _UP4_TAACCAAAAAGCGGTGCTCG
  • BKK10770 (Δ[gene|DC0FDCA3FA6742B023E6877CE9554AA1D47012BB|wprA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTATCCCTCCTGCAAA, downstream forward: _UP4_TAACCAAAAAGCGGTGCTCG
  • References


  • 25212246
  • Original publications

  • 22900538,22923395,23180473,21815947,10075409,11987133,9004506,20525796,18957862,18763711,16306698,9687444,12028417,24362423,24115457,10588904