SubtiBank SubtiBank
gerKD
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

gerKD

negative effector (D protein) of the [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|GerKA]-[protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|GerKB]-[protein|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|GerKC] germinant receptor
locus
BSU_03690
pI
10.01
mw
8.25 kDa
protein length
gene length
222 bp Sequence Blast
function
germination
product
negative effector of the [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|GerKA]-[protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|GerKB]-[protein|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|GerKC] germinant receptor
essential
no
synonyms
yczF

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.1|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    419,763 → 419,984

    Phenotypes of a mutant

  • faster [SW|germination] with the AGFK germinant mixture [Pubmed|23625846]
  • higher sensitivity to AGFK germinants ([SW|germination] at lower concentrations) [Pubmed|23625846]
  • The protein

    [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|23625846], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during [SW|sporulation] in the forespore ([protein|search|SigG]) [Pubmed|23625846]
  • view in new tab

    Biological materials

    Mutant

  • BKE03690 (Δ[gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCATCATCCTCCGC, downstream forward: _UP4_AACCCCTAAAGGGGGGCGCT
  • BKK03690 (Δ[gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCATCATCCTCCGC, downstream forward: _UP4_AACCCCTAAAGGGGGGCGCT
  • References

  • 23625846,22383849,27766092