SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


79.08 kDa
protein length
687 aa Sequence Blast
gene length
2064 bp Sequence Blast
galactan utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of galactan]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,503,020 → 3,505,083

    Phenotypes of a mutant

  • a ''[gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]-[gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]-[gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]-[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]-[gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]'' mutant is impaired in the utilization of galactan [Pubmed|22893383]
  • The protein

    Catalyzed reaction/ biological activity

  • degradation of galactotriose to galactose [Pubmed|22893383]
  • degradation of ß-1.4-galactobiose to galactose [Pubmed|28617843]
  • Hydrolysis of terminal non-reducing beta-D-galactose residues in beta-D-galactosides (according to UniProt)
  • Protein family

  • glycosyl hydrolase 42 family (with [protein|3226901F1D7C1F21296AB974CAE3656C18BE8F69|YesZ], according to UniProt)
  • Modification

  • phosphorylated on Arg-387 [Pubmed|22517742]
  • Effectors of protein activity

  • inhibited by galactose [pubmed|28617843]
  • Structure

  • [PDB|4OJY] (from Geobacillus stearothermophilus, 76% identity) [pubmed|24100561]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|27501980], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]: repression, [Pubmed|9287030], in [regulon|1F787F70C87DEB221709579122D63C2322A84E56|GanR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|28617843], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galactan (binding of galactobiose to [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]) [Pubmed|28617843,27501980]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|28617843,27501980]
  • view in new tab

    Biological materials


  • GP1181 (aphA3) available in [SW|Jörg Stülke]'s lab
  • GP2147 (phleo) available in [SW|Jörg Stülke]'s lab
  • 1A785 ( ''ganA''::''spec''), [Pubmed|11274134], available at [ BGSC]
  • 1A786 ( ''ganA''::''spec''), [Pubmed|11274134], available at [ BGSC]
  • BKE34130 (Δ[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACATTCTCCTCCTTGT, downstream forward: _UP4_TAGGCTGATGCTCCGCTCGA
  • BKK34130 (Δ[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACATTCTCCTCCTTGT, downstream forward: _UP4_TAGGCTGATGCTCCGCTCGA
  • References

  • 2104611,9287030,17056685,22517742,22893383,28617843,27501980,24100561