SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


79.08 kDa
protein length
687 aa Sequence Blast
gene length
2064 bp Sequence Blast
galactan utilization

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of galactan]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,503,020 → 3,505,083

    Phenotypes of a mutant

  • a ''[gene|D4A5A878F87EBC14C02824233155CEBACEB41343|ganS]-[gene|75B1FD4AA7612B3B600CB0CE35319A6960536095|ganP]-[gene|676932E7DF143DC9AAAF1F415FB3D14EE25B2C2F|ganQ]-[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]-[gene|9DDEF5682B2D145830F33C7A1D5A6EC8527BB405|ganB]'' mutant is impaired in the utilization of galactan [Pubmed|22893383]
  • The protein

    Catalyzed reaction/ biological activity

  • degradation of galactotriose to galactose [Pubmed|22893383]
  • degradation of ß-1.4-galactobiose to galactose [Pubmed|28617843]
  • Protein family

  • glycosyl hydrolase 42 family (according to Swiss-Prot)
  • Modification

  • phosphorylated on Arg-387 [Pubmed|22517742]
  • Effectors of protein activity

  • inhibited by galactose [pubmed|28617843]
  • Structure

  • [PDB|4OJY] (from Geobacillus stearothermophilus, 76% identity) [pubmed|24100561]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|27501980], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]: repression, [Pubmed|9287030], in [regulon|1F787F70C87DEB221709579122D63C2322A84E56|GanR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [pubmed|28617843], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by galactan (binding of galactobiose to [protein|1F787F70C87DEB221709579122D63C2322A84E56|GanR]) [Pubmed|28617843,27501980]
  • repressed by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|28617843,27501980]
  • view in new tab

    Biological materials


  • GP1181 (aphA3) available in [SW|Jörg Stülke]'s lab
  • GP2147 (phleo) available in [SW|Jörg Stülke]'s lab
  • 1A785 ( ''ganA''::''spec''), [Pubmed|11274134], available at [ BGSC]
  • 1A786 ( ''ganA''::''spec''), [Pubmed|11274134], available at [ BGSC]
  • BKE34130 (Δ[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACATTCTCCTCCTTGT, downstream forward: _UP4_TAGGCTGATGCTCCGCTCGA
  • BKK34130 (Δ[gene|DBBA549C2D71CF628E92AC7B659EA276E227D742|ganA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACATTCTCCTCCTTGT, downstream forward: _UP4_TAGGCTGATGCTCCGCTCGA
  • References

  • 2104611,9287030,17056685,22517742,22893383,28617843,27501980,24100561