SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


14.87 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,102,560 → 1,102,955

    Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|15699190]
  • view in new tab

    Biological materials


  • MGNA-A712 (yhfM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10280 (Δ[gene|DB3A93634AA8EC779232569A222D78DE2DA582C6|yhfM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCACTCCAAACA, downstream forward: _UP4_TGAAAATGAAAAAGCGAAGC
  • BKK10280 (Δ[gene|DB3A93634AA8EC779232569A222D78DE2DA582C6|yhfM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCACTCCAAACA, downstream forward: _UP4_TGAAAATGAAAAAGCGAAGC
  • References

  • 16497325,15699190