SubtiBank SubtiBank
yhfM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhfM

unknown
locus
BSU_10280
pI
8.43
mw
14.87 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,102,560 → 1,102,955

    Expression and Regulation

    Operons

    genes
    [gene|DB3A93634AA8EC779232569A222D78DE2DA582C6|yhfM]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A712 (yhfM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/712 NBRP B. subtilis, Japan]
  • BKE10280 (Δ[gene|DB3A93634AA8EC779232569A222D78DE2DA582C6|yhfM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCACTCCAAACA, downstream forward: _UP4_TGAAAATGAAAAAGCGAAGC
  • BKK10280 (Δ[gene|DB3A93634AA8EC779232569A222D78DE2DA582C6|yhfM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCACTCCAAACA, downstream forward: _UP4_TGAAAATGAAAAAGCGAAGC
  • References

  • 16497325,15699190