SubtiBank SubtiBank
yhfM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhfM

unknown
locus
BSU10280
pI
8.43
mw
14.87 kDa
protein length
131 aa Sequence Blast
gene length
396 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,102,560 → 1,102,955

    Expression and Regulation

    Operons

    genes
    [gene|DB3A93634AA8EC779232569A222D78DE2DA582C6|yhfM]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A712 (yhfM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/712 NBRP B. subtilis, Japan]
  • BKE10280 (Δ[gene|DB3A93634AA8EC779232569A222D78DE2DA582C6|yhfM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCACTCCAAACA, downstream forward: _UP4_TGAAAATGAAAAAGCGAAGC
  • BKK10280 (Δ[gene|DB3A93634AA8EC779232569A222D78DE2DA582C6|yhfM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGCATCACTCCAAACA, downstream forward: _UP4_TGAAAATGAAAAAGCGAAGC
  • References

  • 16497325,15699190