SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


iron-sulphur cluster assembly factor
11.18 kDa
protein length
102 aa Sequence Blast
gene length
309 bp Sequence Blast
assembly of iron-sulphur clusters
iron-sulphur cluster assembly factor

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW|Biosynthesis of iron-sulfur clusters]
  • Gene

    1,192,254 → 1,192,562

    The protein

    Protein family

  • MIP18 family (single member, according to UniProt)
  • [SW|Domains]

  • DUF59 [pubmed|28589301]
  • Structure

  • [PDB|3LNO] (from B. antracis, 58% identity)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A509 (yitW::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11160 (Δ[gene|DB374B763EE496FA5F0904686384D94170CE47E3|yitW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTCCCTCACTCCTTTT, downstream forward: _UP4_TAAAACAAAAAAGGACAGCC
  • BKK11160 (Δ[gene|DB374B763EE496FA5F0904686384D94170CE47E3|yitW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTCCCTCACTCCTTTT, downstream forward: _UP4_TAAAACAAAAAAGGACAGCC
  • References


  • 28589301
  • Research papers

  • 27517714,27671355