SubtiBank SubtiBank
arsC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

arsC

arsenate reductase
locus
BSU25780
pI
4.75
mw
15.45 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
function
detoxification of arsenate
product
arsenate reductase
essential
no
ec
3.1.3.48
synonyms
yqcM

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,655,322 → 2,655,741

    The protein

    Catalyzed reaction/ biological activity

  • Protein tyrosine phosphate + H2O = protein tyrosine + phosphate (according to Swiss-Prot)
  • Protein family

  • low molecular weight phosphotyrosine protein phosphatase family (with [protein|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|YfkJ] and [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE], according to UniProt)
  • Structure

  • [PDB|1Z2D] (reduced form), [PDB|1Z2E] (oxidized form), [PDB|2IPA] (TrxA-ArsC-complex) [Pubmed|17303556], [PDB|1JL3]
  • Expression and Regulation

    Operons

    genes
    [gene|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|arsR]-[gene|74B1AF103E6B236609CD184A1A409A9A04857181|yqcK]-[gene|B749D54249A28A471EF796903A34622A16D5B0BB|arsB]-[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]
    description
    [Pubmed|9537360]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9537360], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR]: repression, [Pubmed|9537360], in [regulon|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • BKE25780 (Δ[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTCCACCTCTACAT, downstream forward: _UP4_TAAATAAACTCTTTTGTTAA
  • BKK25780 (Δ[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25780 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTCCACCTCTACAT, downstream forward: _UP4_TAAATAAACTCTTTTGTTAA
  • References

  • 16497325,11679756,9537360,17303556,21258851,25494643