SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


arsenate reductase
15.45 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
detoxification of arsenate
arsenate reductase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,655,322 → 2,655,741

    The protein

    Catalyzed reaction/ biological activity

  • [thioredoxin]-dithiol + arsenate + H+ --> [thioredoxin]-disulfide + arsenite + H2O (according to UniProt)
  • Protein family

  • low molecular weight phosphotyrosine protein phosphatase family (with [protein|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|YfkJ] and [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE], according to UniProt)
  • Structure

  • [PDB|1Z2D] (reduced form), [PDB|1Z2E] (oxidized form), [PDB|2IPA] (TrxA-ArsC-complex) [Pubmed|17303556], [PDB|1JL3]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9537360], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR]: repression, [Pubmed|9537360], in [regulon|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • BKE25780 (Δ[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTCCACCTCTACAT, downstream forward: _UP4_TAAATAAACTCTTTTGTTAA
  • BKK25780 (Δ[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTCCACCTCTACAT, downstream forward: _UP4_TAAATAAACTCTTTTGTTAA
  • References

  • 16497325,11679756,9537360,17303556,21258851,25494643