SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


arsenate reductase
15.45 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
detoxification of arsenate
arsenate reductase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.11|Resistance against toxic metals]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,655,322 → 2,655,741

    The protein

    Catalyzed reaction/ biological activity

  • [thioredoxin]-dithiol + arsenate + H+ --> [thioredoxin]-disulfide + arsenite + H2O (according to UniProt)
  • Protein family

  • low molecular weight phosphotyrosine protein phosphatase family (with [protein|2CEFD8D9692D062CC09E3DEDA1A4015C76BC4167|YfkJ] and [protein|1BAD28287257F82F907706AFD2E8FF5F3BD1B57B|YwlE], according to UniProt)
  • Structure

  • [PDB|1Z2D] (reduced form), [PDB|1Z2E] (oxidized form), [PDB|2IPA] (TrxA-ArsC-complex) [Pubmed|17303556], [PDB|1JL3]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9537360], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR]: repression, [Pubmed|9537360], in [regulon|B3D88B9C89154B77D77FB833CA16FD4F4E29FE96|ArsR regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • BKE25780 (Δ[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTCCACCTCTACAT, downstream forward: _UP4_TAAATAAACTCTTTTGTTAA
  • BKK25780 (Δ[gene|DB3527FB78D0B7C144D1699D665788184F19AFE0|arsC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATTCCACCTCTACAT, downstream forward: _UP4_TAAATAAACTCTTTTGTTAA
  • References

  • 16497325,11679756,9537360,17303556,21258851,25494643